I miss those days, now it’s all boring version control
The most gorilla gorilla that ever gorillaed.
Shit, here we go again.
Buffalo buffalo Buffalo buffalo buffalo buffalo Buffalo buffalo.
Ignoring capitalisation you can add as many buffalos as you like and still be parsable. I’ve only ever heard buffalo used as a verb in this one context, though, so seems a bit forced to me
Gorilla gorilla, Gorilla gorilla gorilla, gorilla Gorilla gorilla
Maybe at some point we’ll have version control for all DNA mapping so each minor change is a commit hash and each major release is a tag
We do, the major versions have tag releases like mm7, mm8, mm9, etc. as defined by the current build, and minor patch releases too like mm10p14 as new sequences come in.
https://hgdownload.cse.ucsc.edu/goldenpath/mm10/bigZips/
Example, say you have 5 sequences: CAT, ATC, ATCG, CGT, and ATATA.
One way of combining them up together to build a transcriptome is like this:
5 sequences: ATATA CG-T ATC ATCG CAT Reference: ATCGATATATCATCGATATATC isn’t the only solution to these sequences, but as you get more sequences to try and overlap, the more the uncertainty goes down
That’s really interesting, thanks for sharing
