fossilesque@mander.xyzM to Science Memes@mander.xyzEnglish · 1 year agooriginalitymander.xyzexternal-linkmessage-square12fedilinkarrow-up1302arrow-down17
arrow-up1295arrow-down1external-linkoriginalitymander.xyzfossilesque@mander.xyzM to Science Memes@mander.xyzEnglish · 1 year agomessage-square12fedilink
minus-squarekautau@lemmy.worldlinkfedilinkEnglisharrow-up5·1 year agoMaybe at some point we’ll have version control for all DNA mapping so each minor change is a commit hash and each major release is a tag
minus-squaretetris11@lemmy.mllinkfedilinkEnglisharrow-up2·edit-21 year agoWe do, the major versions have tag releases like mm7, mm8, mm9, etc. as defined by the current build, and minor patch releases too like mm10p14 as new sequences come in. https://hgdownload.cse.ucsc.edu/goldenpath/mm10/bigZips/ Example, say you have 5 sequences: CAT, ATC, ATCG, CGT, and ATATA. One way of combining them up together to build a transcriptome is like this: 5 sequences: ATATA CG-T ATC ATCG CAT Reference: ATCGATATATC ATCGATATATC isn’t the only solution to these sequences, but as you get more sequences to try and overlap, the more the uncertainty goes down
minus-squarekautau@lemmy.worldlinkfedilinkEnglisharrow-up2·1 year agoThat’s really interesting, thanks for sharing
Maybe at some point we’ll have version control for all DNA mapping so each minor change is a commit hash and each major release is a tag
We do, the major versions have tag releases like mm7, mm8, mm9, etc. as defined by the current build, and minor patch releases too like mm10p14 as new sequences come in.
https://hgdownload.cse.ucsc.edu/goldenpath/mm10/bigZips/
Example, say you have 5 sequences: CAT, ATC, ATCG, CGT, and ATATA.
One way of combining them up together to build a transcriptome is like this:
5 sequences: ATATA CG-T ATC ATCG CAT Reference: ATCGATATATCATCGATATATC isn’t the only solution to these sequences, but as you get more sequences to try and overlap, the more the uncertainty goes down
That’s really interesting, thanks for sharing